1 2 3 4 5 6 7 8 9 10

5Conclusion - Transat transcriptome Analysis Tool

səhifə8/10
tarix24.11.2017
ölçüsü340.73 Kb.

5Conclusion

La solution informatique retenue pour répondre aux besoins de l’équipe du Dr. Wasylyk, alliant une base de données relationnelle à un programme dédié à l’analyse de séquences, a permis de regrouper l’ensemble des données biologiques acquises jusqu’à présent, ainsi que d’analyser automatiquement la majeure partie des séquences disponibles.

Cette solution permet une exploitation plus globale des résultats biologiques obtenus, et ce à deux niveaux : l’exploitation peut se faire, au niveau d’une expérience, pour l’ensemble des gènes traités par les différents expérimentateurs, mais aussi au niveau d’un gène, pour l’ensemble des expériences.

Les deux modules de cette solution sont amenés à évoluer : l’analyse de séquences peut être affinée, et la base de données doit notamment s’orienter vers l’Internet.

Ce stage a été pour moi l’occasion de mettre en pratique la création d’une base de données, et de me familiariser avec les techniques d’étude de l’expression génique, avec l’analyse de séquences, et avec un nouveau langage de programmation (TCL).

J’ai également découvert le travail des bioinformaticiens en partenariat avec les biologistes, et par là même les enjeux d’un tel partenariat. En effet, la bioinformatique permet ici aux biologistes une gestion facilitée de leurs nombreuses données. Mais rappelons également que l’analyse de séquences, menée en partenariat avec l’équipe de bioinformatique du Laboratoire de Biologie et de Génomique Structurales, a donné lieu à l’élaboration d’un protocole d’analyse de séquences nucléiques humaines, ce qui représente une étape importante pour l’un des axes de recherche de cette équipe, à savoir l’étude des génomes eucaryotes.

J’ai enfin été confrontée à certains défis, comme la nécessité de maîtriser deux disciplines donc deux langages, ou encore le travail avec une définition floue et évolutive des besoins.

Glossaire

(cf. [4], [5], [6])


ADN

Abréviation d'Acide DésoxyriboNucléique. Macromolécule servant de support de l'information génétique chez la plupart des êtres vivants (la seule exception connue étant les virus à ARN). L'ADN se trouve dans presque toutes les cellules. Il est aussi présent dans certains organites cellulaires (chloroplastes et mitochondries). Chez les procaryotes, il est dans le cytoplasme ; chez les eucaryotes, il est dans un organite spécialisé, le noyau cellulaire. Sa structure est universelle, seule la longueur de la molécule variant selon les espèces. Constituant des chromosomes et de la chromatine, l'ADN est le support matériel de l'information et du patrimoine génétiques.

Un brin d'ADN est constitué d'une chaîne plus ou moins longue de désoxyribonucléotides (nucléotides comportant un sucre, le désoxyribose, et une base azotée choisie parmi la thymine T, la cytosine C, l'adénine A et la guanine G). Chaque base est appariée à une autre, dite complémentaire, par des liaisons hydrogène, suivant deux couples possibles : A--T et G--C.

L'ADN est constitué de deux brins. Chaque base d’un brin est appariée à une base de l’autre brin qui lui est complémentaire. Les deux brins reliés complémentaires sont arrangés en double hélice.


ADN complémentaire (ADNc ou cDNA)

ADN simple brin synthétisé à partir d’un brin d’ARN : il est obtenu après une réaction de transcription inverse d'un ARN matur et représente ainsi la copie de l'ARN. En biologie moléculaire, cette synthèse permet d’obtenir des copies d’ARN messager sous forme d’ADN : l'ADNc offre l’avantage d'être plus stable que la molécule d'ARNm et de pouvoir être stocké, copié et séquencé.


ARN

Abréviation de Acide RiboNucléique. Acide nucléique à structure proche de celle de l'ADN, qui joue un rôle capital dans la synthèse des protéines et constitue le support de l'information génétique chez certains virus. Le sucre présent dans les nucléotides de l'ARN est le ribose ; les quatre bases azotées sont l'adénine A, la cytosine C, la guanine G, l'uracile U remplaçant la thymine T présente dans l'ADN, dans les appariements avec A. L'ARN est moins stable que l'ADN, et son rôle est généralement celui d'une molécule transitoire, à durée de vie relativement courte. L'ARN est constitué d'un seul brin, ce qui lui permet de présenter de nombreuses structures (boucles, doubles chaînes), qui jouent un rôle important dans la régulation de la traduction. En biologie moléculaire, on utilise l'enzyme appelée transcriptase inverse pour copier l'ARN en ADN (dit ADNc ou cDNA) afin de pallier le peu de maniabilité de l'ARN.

On rencontre différents types d'ARN dans les cellules (ARN messager ou mRNA, ARN de transfert ou tRNA, ARN ribosomal ou rRNA).

Voir Transcription, Traduction.


ARN messager (ARNm ou mRNA)

Molécule d'ARN (comprenant entre 1000 et 50000 bases), produite par la cellule à partir de l'A.D.N. lors de la transcription, à l'origine de la matrice sur laquelle viennent se synthétiser les protéines. La maturation éventuelle ou épissage des pré-ARNm issus de la transcription leur permet d'acquérir une structure fonctionnelle. La séquence des bases azotées portées par les nucléotides d'un ARNm porte le code nécessaire à la synthèse d'une protéine. La lecture de ce code est effectuée par le ribosome au cours de la traduction. Les ARNm sont éliminés très rapidement et ne représentent en moyenne qu'un pour cent de la masse des ARN d'une cellule.


Biopsie

Prélèvement sur le corps vivant d'un fragment de tissu ou d'organe en vue d'un examen microscopique ou d'une analyse biochimique.

BLAST

Basic Local Alignment Search Tool


bp

Unité de mesure de la taille d’une séquence d'ADN en paires de bases. kb : kilo paires de bases = 1000 bp.

Cancer

Tumeur maligne formée par la multiplication désordonnée de cellules.

cDNA

Voir ADN complémentaire.


Champ

Colonne d'une table. Ensemble des valeurs qui correspondent à une même propriété (exemple : champ Séquence de la table Clones). Toutes les données d'une colonne sont de même type.


Clé primaire

Propriété ou ensemble de propriétés (colonne ou ensemble de colonnes) identifiant une ligne de façon unique. Par définition, la clé primaire doit donc avoir une valeur différente pour chaque ligne.


Contig

Séquence obtenue en joignant une collection de séquences chevauchantes. Dans le cas du génome humain, les contigs sont des fragments de chromosome contenant des séquences (gènes ou non) dans un ordre connu. Mais la localisation précise de ces contigs sur le chromosome et leur position relative n'est pas forcément connue.


DATAS

Differential Analysis of Transcripts with Alternative Splicing : analyse des exons et introns, ou des insertions et délétions dans une population de mRNA.


DNA

cf. ADN

DNA transposons

Ces séquences répétées contiennent le gène de la transposase, sans intron, entouré de deux courtes séquences répétées inversées.

Eléments transposables avec LTR (Long Terminal Repeats)

Ces séquences répétées ont une longueur allant de 1.5 à 10 kb. Contrairement aux LINEs et aux SINEs, elles contiennent le gène de la transcriptase inverse (cf. Transcription inverse), entouré de séquences repeats dites terminales de 300 à 1000 bp. Cette catégorie de séquences répétées comprend les rétrovirus endogènes humains non fonctionnels (hERV).


Enzyme

Protéine produite par un être vivant pour catalyser des réactions biochimiques spécifiques, dans des conditions compatibles avec la vie.


Epissage – Epissage alternatif

Phénomène de maturation des ARN messagers chez les eucaryotes : certaines parties sont "découpées" (excisées) après la transcription et non exprimées lors de la traduction (ce sont les introns). Les autres parties (exons) sont recollées (épissées) et les bases azotées de leurs nucléotides codent effectivement pour la protéine exprimée. Lors de l'épissage, certains exons peuvent être enlevés avec les introns, on parle alors d'épissage alternatif puisque un même gène peut donner naissance à plusieurs ARN messagers avec des combinaisons d'exons différentes.


EST

Expressed Sequence Tag. Une séquence EST est une étiquette (fragment d'une extrémité) d'un ADNc. Une séquence EST est donc une séquence de 100 à 150 nucléotides d'ADNc correspondant à une des extrémités d'un ARNm.


Eucaryote

Etre vivant dont le matériel génétique de chaque cellule est enfermé dans un noyau limité par une double membrane (champignons, levures, animaux, végétaux). L'existence de ce noyau cellulaire donne son nom aux acides nucléiques comme l'ADN et l'ARN.

Voir Procaryote.

Exérèse

Ablation chirurgicale d'un tissu ou organe inutile ou nuisible à l'organisme, ou d'un corps étranger.


Exon

Partie d'un gène eucaryote qui contient une séquence codante et qui est susceptible d'être conservée dans l'ARN lors de l'épissage. Chez les organismes eucaryotes, tout l'ARN. issu de la transcription de la molécule d'ADN ne se retrouve pas dans les ARN messagers cytoplasmiques (V. cytoplasme). L'épissage élimine des séquences non codantes (introns) et joint les séquences codantes (exons) bout à bout.

Voir Intron.

Gène

Le gène correspond à un fragment de la molécule d'ADN, une séquence de nucléotides, qui comprend un promoteur de transcription suivi d'une séquence codant pour un ARN. Cet ARN peut avoir une fonction biologique ou coder pour une protéine. Par l'intermédiaire de ces protéines (enzymes, récepteurs, canaux, anticorps…), les gènes déterminent les caractéristiques et propriétés de l'organisme (son immunité, sa croissance, etc...). Certaines parties des gènes (les introns) ne sont pas exprimées en protéines lors de la traduction (car ils sont éliminés au cours de l'épissage chez les eucaryotes), les séquences codant la synthèse d'une protéine s'appellent exons. L'expression des gènes est régulée à différents stades de leur action.


Génome

Totalité du matériel génétique chromosomique d’un organisme.


Hybridation

Appariement entre séquences nucléiques complémentaires par des liaisons hydrogènes spécifiques, A-T et G-C pour l'ADN ; A-U et G-C pour l'ARN.


Intron

Partie d'un gène non traduite en protéine parce que la séquence correspondante est excisée de l'ARN. lors de la maturation en A.R.N. messager (épissage). Les introns n'existent que chez les eucaryotes. Ils peuvent constituer la majeure partie d'un gène. Ils contiennent parfois des séquences régulatrices, mais il est généralement impossible de leur attribuer un rôle quelconque.

Voir Exon.

LINEs

Long Interspersed Nuclear Elements. Ils contiennent l’élément L1 (Kpn repeat) associé à des régions riches en A-T. Présents chez les mammifères, leur longueur est généralement de 6 à 8 kb. Comme les SINEs, les LINEs peuvent être transcrits (ils contiennent des promoteurs pour la RNA polymérase III), mais ne codent pour aucune protéine capable de catalyser une rétrotransposition.


Métastase

Foyer de dissémination secondaire d'une tumeur maligne primitive se développant généralement à distance de celle-ci.

mRNA

Voir ARN messager.


Nucléotide

Constituant élémentaire des acides nucléiques (ADN ou ARN), composé d'une base azotée (adénine A, guanine G, cytosine C, ou thymine T dans l'ADN ou uracile U dans l'ARN), associée à un ou plusieurs phosphates, et à un sucre (ribose dans l'ARN ou à un désoxyribose dans l'ADN).


PCR

Polymerase Chain Reaction. Le but de cette méthode est de multiplier en chaîne une petite quantité d'ADN disponible. Elle consiste à répéter n fois le cycle suivant :



  1. la séparation des deux brins d'ADN grâce à une température élevée (environ 95°C) afin d'obtenir des molécules d'ADN monobrin

  2. l'hybridation d'oligonucléotides (amorces) complémentaires d'une séquence de l'ADN monobrin à amplifier (la température est alors ramenée à une valeur comprise entre 40°C et 65°C afin de permettre une bonne hybridation des amorces)

  3. la réaction de synthèse du brin complémentaire par une ADN polymérase thermostable (la Taq Polymerase) à partir des oligonucléotides, réalisée à la température optimale de 72°C.

  1. les deux brins d'ADN sont séparés grâce à une température élevée, etc.

Procaryote

Se dit des cellules dépourvues de noyau cellulaire. Les êtres vivants procaryotes sont généralement unicellulaires comme les bactéries, les cyanobactéries, les archéobactéries. Leur matériel génétique est de l'ADN circulaire diffus dans le cytoplasme de la cellule.

Voir Eucaryote.

Protéine

Macromolécule organique composée essentiellement d'acides aminés reliés par la liaison peptidique. Seuls vingt acides aminés entrent dans la composition des protéines naturelles. Les protéines interviennent dans toutes les réactions biochimiques des organismes, notamment grâce à leur structure spatiale. Une protéine est l'expression d'un gène qui permet sa synthèse au sein des cellules, au cours du processus de traduction des ARN messagers.


Ribosome

Complexe présent dans le cytoplasme de la cellule, constitué de plusieurs parties protéiques et d'ARN ribosomal. Les ribosomes interviennent dans la synthèse des protéines. Ils effectuent, avec l'aide des ARN de transfert, la traduction en protéines des ARNm, sur lesquels ils s'accrochent.


RNA

Voir ARN.


RT-PCR

Reverse Transcription Polymerase Chain Reaction. Amplification par PCR de cDNA issus de transcrption inverse d’ARN messagers.


Séquence peptidique

Ordre des acides aminés sur la chaîne d’acides aminés formant une protéine. Chaque acide aminé est représenté par une lettre (V pour valine, L pour leucine…)


Séquence nucléique

Ordre des bases sur la chaîne linéaire de nucléotides formant un acide nucléique (ADN ou ARN) : chaque nucléotide étant représenté par l’initiale de la base qui le constitue (T pour thymine, C pour cytosine, A pour adénine et G pour guanine).


SGBD

Système de gestion de bases de données. Ensemble coordonné de logiciels capable de décrire, mémoriser, manipuler, interroger les ensembles de données constituant les bases, et capable de gérer la sécurité et la confidentialité dans un environnement multi-utilisateurs avec des besoins variés et pouvant interagir simultanément sur ces données.


SINEs

Short Interspersed Nuclear Elements. Cette famille comprend notamment les « Alu repeat », nommées ainsi car elles ont été caractérisées grâce à l’enzyme de restriction Alu. Ces séquences, spécifiques des primates et riches en G-C, sont les plus abondantes dans le génome humain avec un nombre de copies supérieur à 106. Elles se trouvent le plus souvent dans les régions non traduites (introns) et leur fonction est inconnue. Leur longueur est de 280 bp environ. Les SINEs peuvent être transcrits (ils contiennent des promoteurs pour la RNA polymérase III), mais ne codent pour aucune protéine capable de catalyser une rétrotransposition.


SQL

Structured Query Language. Langage de manipulation de bases de données développé par IBM. C'est un standard industriel.


Table

Suite de lignes, ou enregistrements. Toutes les lignes ont même structure, ou format.


Traduction

Processus au cours duquel le message génétique des ARN messagers est traduit en la séquence d'acides aminés codée par cet ARN. Le code pour chaque acide aminé successif est une combinaison de trois nucléotides (triplet ou codon) qui sont déchiffrés les uns après les autres au niveau du ribosome : lors de la traduction, les deux sous-unités du ribosome s'assemblent à une extrémité d'un ARNm correspondant au début de la séquence codante. Le ribosome va ensuite progresser de codon en codon (trois nucléotides) jusqu'à la fin de la molécule d'ARN. A chaque codon, le ribosome s'arrête, et un acide aminé est ajouté à la chaîne protéique naissante, en fonction du codon, selon la règle du code génétique.


Transcription

Transfert de l'information génétique d'un gène, depuis une molécule d'ADN vers une molécule d'ARN.

Ce processus est effectué par l'ARN polymérase, un ensemble d'enzymes (appelé aussi transcriptase) qui recopie un brin d'ADN en ARN. Les nucléotides de l'A.R.N. sont assemblés en une chaîne complémentaire de la séquence de nucléotides de l'A.D.N. (aux bases azotées C, A, G et T de l'ADN correspondent respectivement les bases A,C,U et G de l'ARN). L'ARN se détache lorsque le signal de fin de transcription est décodé. Il subit alors plusieurs maturations (dont la polyadénylation et l’épissage) pour devenir un ARN messager (ARNm).

Transcription inverse

Action de la transcriptase inverse, enzyme qui fabrique un brin d'ADN dit ADN complémentaire à partir d’un brin d’ARN. Cette enzyme n'est trouvée qu'en accompagnement de certains virus dits rétrovirus. Ce processus, inverse de la transcription normale, est utilisé en biologie moléculaire pour synthétiser de l’ADN complémentaire des brins d’ARNm.


Tumeur

Augmentation de volume d'un tissu ou d'une partie d'un organe, due à une multiplication des cellules. Ces tumeurs peuvent être bénigne (sans gravité) ou malignes (cancers).


UTR

Untranslated Region. Partie non traduite d'un ARNm située à l'une de ses extrémités (3' ou 5').


VADS

Voies Aéro-Digestives Supérieures : bouche, pharynx, fosses nasales, sinus et larynx.


VBA

Visual Basic for Applications


Références

Encyclopédie



  1. Encyclopédie® Microsoft® Encarta 97. © 1993-1996 Microsoft Corporation

Sites Internet


Cours de biologie :

  1. http://www.biology.com/learning/transcription/images/euovrvw.gif

  2. http://www.neuro.wustl.edu/neuromuscular/mother/dnarep.htm

Dictionnaires de biologie :



  1. http://www.sciences-en-ligne.com/Dictionnaire/List_themes.asp

  2. http://www.atoute.org/dictionnaire_medical.htm

  3. http://perl.club-internet.fr/cgi-bin/ehmel/ehmel_search.pl?query=biopsie

Techniques de génétique :



  1. http://www.univ-montp1.fr/biotech/Genomique/Genomique_contenu.htm

Banques et analyse de séquences :



  1. http://www-igbmc.u-strasbg.fr/TUTORIAL/ATRIUM/atrium.html

Autres


Rapport de DEA :

  1. Anne Cromer, Identification de gènes différentiellement exprimés dans les cancers des VADS par la technique de Differential Display, 2000

Annexe

Illustration du protocole d’analyse de séquences des clones


On étudie par exemple le cDNA humain13 dont la séquence est la suivante (format FastA) :
>Homo sapiens cDNA

GTAAGGGTGTACTAGGGGATAGGATGATGTAAGAGAATGAGAAAGATGAC

CAAAAGGTTGGTGGTAGGGAGGCTTTTTCGTTATTTCCAAATACTTGAGA

AATTACCTTTTGGTTTACAAATCTATGATCAACTTATTCCATTAAATAGA

TACATTAAAAAAATTAAAAACTGATTCTTCTGCAGAGCACTGGTGTTTCT

TTTTATAACCCCTTGAAACAAGTCTCTCACCTGAGCCTGTCTAAACTTTC

GGAGGGAGTTTATTATTGAGTCTTTATCTGTGACAGTATTTGGAGATTTA

GGGATTTGATACTTAGGCCTTTGAATTTTAGAATACAAAAAGAGAAGCAA

GCCAGACATGGTGGCTCACACCTGTAATCCCAATACTGGGAAGCCAAGGT

GGGAGTATCGCTTGAGCCCAGGAGTTTGAGACCGACATGGGCAACATGAC

AAGACCCCATCTCTACAAAAAAATTAAAAAATTAGCCAGGCATGGTGGCA

CATGCCTACTCCCAGCTCCCAAGGAGACTGAGATGGGAGGATCCCTGGAG

CCCTGAAGCTTGAGGCTACAGTGAGCCTTGATTGTGTCACTGCACTCCAG

CTTGGGATGAACAGAGACCCCTGTCTCGACGAAATTAAACCCAAAAAAAC

AGAAACAAAAAAAAGAGACGCCGGGGGGACCATAAAAGAAAAAAAACTAA

GAAAAAACTGGGAGCACACACGACCACGGGGGCCAAAGAACGGTAAAACA

TAGACGAACACAAG

RepeatMasker


La séquence étudiée est soumise à RepeatMasker. Il retourne la séquence soumise où les séquences répétées sont masquées …
>Homo sapiens cDNA (masked)

GTAAGGGTGTACTAGGGGATAGGATGATGTAAGAGAATGAGAAAGATGAC

CAAAAGGTTGGTGGTAGGGAGGCTTTTTCGTTATTTCCAAATACTTGAGA

AATTACCTTTTGGTTTACAAATCTATGATCAACTTATTCCATTAAATAGA

TACATTAAAAAAATTAAAAACTGATTCTTCTGCAGAGCACTGGTGTTTCT

TTTTATAACCCCTTGAAACAAGTCTCTCACCTGAGCCTGTCTAAACTTTC

GGAGGGAGTTTATTATTGAGTCTTTATCTGTGACAGTATTTGGAGATTTA

GGGATTTGATACTTAGGCCTTTGAATTTTAGAATACAAAAAGAGAAGCAN

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNGAGACGCCGGGGGGACCATAAAAGAAAAAAAACTAA

GAAAAAACTGGGAGCACACACGACCACGGGGGCCAAAGAACGGTAAAACA

TAGACGAACACAAG
… ainsi qu’un fichier décrivant les séquences répétées détectées :
==================================================

file name: exseq.txt

sequences: 1

total length: 764 bp

GC level: 42.41 %

bases masked: 315 bp ( 41.23 %)

==================================================

number of length percentage

elements* occupied of sequence

--------------------------------------------------

SINEs: 1 315 bp 41.23 %

ALUs 1 315 bp 41.23 %

MIRs 0 0 bp 0.00 %

LINEs: 0 0 bp 0.00 %

LINE1 0 0 bp 0.00 %

LINE2 0 0 bp 0.00 %

L3/CR1 0 0 bp 0.00 %

LTR elements: 0 0 bp 0.00 %

MaLRs 0 0 bp 0.00 %

ERVL 0 0 bp 0.00 %

ERV_classI 0 0 bp 0.00 %

ERV_classII 0 0 bp 0.00 %

DNA elements: 0 0 bp 0.00 %

MER1_type 0 0 bp 0.00 %

MER2_type 0 0 bp 0.00 %

Unclassified: 0 0 bp 0.00 %


Total interspersed repeats: 315 bp 41.23 %
Small RNA: 0 0 bp 0.00 %

Satellites: 0 0 bp 0.00 %

Simple repeats: 0 0 bp 0.00 %

Low complexity: 0 0 bp 0.00 %

==================================================
* most repeats fragmented by insertions or deletions

have been counted as one element


The sequence(s) were assumed to be of primate origin.

RepeatMasker version 04/04/2000 default

ProcessRepeats version 04/04/2000

Repbase version 01/04/2001


On voit que RepeatMasker a masqué 41 % de la séquence du cDNA qui lui a été soumis. La séquence répétée masquée est du type « Alu repeat ».

BlastN contre le génome humain


On soumet la séquence donnée par RepeatMasker au programme BlastN pour rechercher les séquences homologues dans le génome humain. On a le fichier de sortie suivant (extrait) :
BLASTN 2.2.1 [Aug-1-2001]
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,

Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),

"Gapped BLAST and PSI-BLAST: a new generation of protein database search

programs", Nucleic Acids Res. 25:3389-3402.


Query= Homo sapiens cDNA (masked)

(764 letters)


Database: Human genome

26,786 sequences; 3,085,169,031 total letters


Searching...................................................done
Score E

Sequences producing significant alignments: (bits) Value


HS12:NT009471_17 Continuation (18 of 20) of NT009471 from base 1... 607 e-171

HS12:NT009471_16 Continuation (17 of 20) of NT009471 from base 1... 607 e-171

HS02:NT022380 NT_022380 Homo sapiens chromosome 2 working draft ... 46 0.031

HS18:NT024993 NT_024993 Homo sapiens chromosome 18 working draft... 44 0.12

HS18:NT024983 NT_024983 Homo sapiens chromosome 18 working draft... 44 0.12

HS15:NT024731 NT_024731 Homo sapiens chromosome 15 working draft... 44 0.12

HS15:NT010204_12 Continuation (13 of 36) of NT010204 from base 1... 44 0.12

HS09:NT024025 NT_024025 Homo sapiens chromosome 9 working draft ... 44 0.12

HS09:NT023947_2 Continuation (3 of 4) of NT023947 from base 2000... 44 0.12

HS09:NT023947_1 Continuation (2 of 4) of NT023947 from base 1000... 44 0.12

HS09:NT023947_0 NT_023947 Homo sapiens chromosome 9 working draf... 44 0.12

HS05:NT006931 NT_006931 Homo sapiens chromosome 5 working draft ... 44 0.12

HS01:NT022035 NT_022035 Homo sapiens chromosome 1 working draft ... 44 0.12

HS22:NT011520_097 Continuation (98 of 230) of NT011520 from base... 42 0.48

HS19:NT011145_01 Continuation (2 of 12) of NT011145 from base 10... 40 1.9

HS09:NT023967_3 Continuation (4 of 7) of NT023967 from base 3000... 40 1.9

HS05:NT006654_02 Continuation (3 of 16) of NT006654 from base 20... 40 1.9

HS05:NT006617_13 Continuation (14 of 16) of NT006617 from base 1... 40 1.9

HS02:NT005465 NT_005465 Homo sapiens chromosome 2 working draft ... 40 1.9

HS02:NT022114_0 NT_022114 Homo sapiens chromosome 2 working draf... 40 1.9


>HS12:NT009471_17 Continuation (18 of 20) of NT009471 from base

1700001 (NT_009471 Homo sapiens chromosome 12 working

draft sequence segment. 2/2001)

Length = 110000


Score = 607 bits (306), Expect = e-171

Identities = 341/351 (97%), Gaps = 3/351 (0%)

Strand = Plus / Minus

Query: 1 gtaagggtgtactaggggat-aggatgat-gtaagagaatgagaaagatgaccaaaaggt 58

|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||

Sbjct: 3584 gtaagggtgtactaggggattaggatgattgtaagagaatgagaaagatgaccaaaaggt 3525


Query: 59 tggtggtagggaggctttttcgttatttccaaatacttgagaaattaccttttggtttac 118

||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||

Sbjct: 3524 tggtggtagggaggctttttc-ttatttccaaatacttgagaaattaccttttggtttac 3466


Query: 119 aaatctatgatcaacttattccattaaatagatacattnnnnnnnttaaaaactgattct 178

|||||||||||||||||||||||||||||||||||||| |||||||||||||||

Sbjct: 3465 aaatctatgatcaacttattccattaaatagatacattaaaaaaattaaaaactgattct 3406


Query: 179 tctgcagagcactggtgtttctttttataaccccttgaaacaagtctctcacctgagcct 238

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct: 3405 tctgcagagcactggtgtttctttttataaccccttgaaacaagtctctcacctgagcct 3346


Query: 239 gtctaaactttcggagggagtttattattgagtctttatctgtgacagtatttggagatt 298

||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct: 3345 gtctaaactttcggagggagtttattattgagtctttatctgtgacagtatttggagatt 3286


Query: 299 tagggatttgatacttaggcctttgaattttagaatacaaaaagagaagca 349

|||||||||||||||||||||||||||||||||||||||||||||||||||

Sbjct: 3285 tagggatttgatacttaggcctttgaattttagaatacaaaaagagaagca 3235

Les fichiers de sortie de Blast (BlastN, TblastN, BlastP…) se présentent tous de la même façon que celui-ci . On trouve :


  • en entête : la version de Blast utilisée et l’article correspondant, l’entête du fichier de la séquence soumise (Query) et la longueur de cette séquence, et la banque de données dans laquelle Blast doit rechercher les similarités

  • la liste des séquences montrant le plus de similarité avec la séquence soumise, triées en fonction de l’expect

  • le détail des zones de correspondance entre la séquence soumise et chacune des séquences de la liste précédente (ici le fichier a été tronqué pour ne montrer que le détail de la meilleure correspondance).

On voit donc ici apparemment deux localisations différentes sur le même chromosome : NT009471_17 et NT009471_16. En réalité, il s’agit d’un artefact dû à la façon dont les contigs sont stockés. En effet, comme il s’agit de très longues séquences, les contigs sont subdivisés en fragments de 110 000 bp, qui se chevauchent sur 10 000 bp. Ici, la séquence homologue à notre cDNA dans le génome humain se trouve dans la zone de chevauchement des fragments 16 et 17 du contig NT009471.


Le cDNA étudié est donc localisé sans ambiguïté sur le fragment 17 (par exemple) du contig numéro NT009471 du chromosome 12, du nucléotide n°3 584 au nucléotide n°3 235 (c’est-à-dire sur le brin Minus, brin complémentaire de celui dont la séquence est stockée dans le fichier NT009471_17 de la banque de données du génome humain).

Dostları ilə paylaş:

©2018 Учебные документы
Рады что Вы стали частью нашего образовательного сообщества.
?


3-sivuxind-v.html

3-slayd---rezha.html

3-sm--zakon-ot-4.html

3-snaye.html

3-socialno.html